circad | circRNAs associated with diseases

hsa_circ_406697
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Breast Cancer	ICD-10	Malignant neoplasm of breast (C50)
DBLink	Link to database	PMID	28484086
Experimental Method
Sample Type	Tissues	Comparison	51 breast cancer samples, matched with adjacent normal-appearing tissues
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GAGACAGATTTAAGGCCTGCC Reverse GGTAGATGTGGCTTTCCCCA	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Lu, L, Sun, J, Shi, P, Kong, W, Xu, K, He, B, Zhang, S, Wang, J (2017). Identification of circular RNAs as a promising new class of diagnostic biomarkers for human breast cancer. Oncotarget, 8, 27:44096-44107.